Detail Information for m6A_site_271712 Result
Help
| ModID | m6A_site_271712 |
|---|---|
| Chromosome | chr3 |
| ModStart | 36864461 |
| ModEnd | 36864462 |
| Strand | + |
| ModType | m6A |
| FullName | N6-methyladenosine |
| ModName | m6A_site_271712 |
| SupportNum | 1 |
| SupportList | GSM1339459, |
| GeneName | 4932438A13Rik,4932438A13Rik,4932438A13Rik |
| GeneType | nonsense_mediated_decay,protein_coding,retained_intron |
| Region | utr5,utr5,exon |
| Sequence |
ATTGAAGATTAAAAAACTAAACAAAATAAAACAAGAAATCT |
| Motif Score | 224.49 |
| PubMed ID | 24981863 |
References:
1: Schwartz S, Mumbach MR, Jovanovic M, Wang T, Maciag K, Bushkin GG, Mertins P, Ter-Ovanesyan D, Habib N, Cacchiarelli D, Sanjana NE, Freinkman E, Pacold ME, Satija R, Mikkelsen TS, Hacohen N, Zhang F, Carr SA, Lander ES, Regev A. Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5` sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26. PubMed PMID: 24981863; PubMed Central PMCID: PMC4142486.
1. The 'Motif score' is alignment score to evaluate the accuracy of identified motif regions of m6A and m1A. The range is from 0 to 500.
2. The sequence is 41-nt long that was extended by an additional 20 nt in both the 5′- and 3′-directions for the modification site.
3. The modName column represents the original names of modification sites.
4. Users can click on a modType within the table to view more detailed information of modType.
5. Users can click on browser to launch a detailed page that provides a intergrated view of the modification site.
6. For m6A and m1A, users can click the GSM accession to view the motif logos and metagene analysis of this sample.
7. Users can click on a pubmedID to link to NCBI to view the detail information about data.
2. The sequence is 41-nt long that was extended by an additional 20 nt in both the 5′- and 3′-directions for the modification site.
3. The modName column represents the original names of modification sites.
4. Users can click on a modType within the table to view more detailed information of modType.
5. Users can click on browser to launch a detailed page that provides a intergrated view of the modification site.
6. For m6A and m1A, users can click the GSM accession to view the motif logos and metagene analysis of this sample.
7. Users can click on a pubmedID to link to NCBI to view the detail information about data.