| mod ID | m1A_site_1103 | mod Site | chrX:154765963-154765964:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m1A | Sequence |
CACCTCTTGCATGTGGTTCAAATCCTCTGAAGAGAGAGATT |
|||||||||||||||||||||||||||||||||
| Motif Score | noScore | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...................((((....)))) |
MFE | -2.80 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 1 | Support sub-Dataset Num | 1 | |||||||||||||||||||||||||||||||||
| Support Dataset List | GSE97419 | |||||||||||||||||||||||||||||||||||
| Support sub-Dataset List | GSE97419 | |||||||||||||||||||||||||||||||||||
| Cell/Tissue List | HEK293T | |||||||||||||||||||||||||||||||||||
| Seq Type List | m1A-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000473552.1,ENST00000620277.4,ENST00000437719.5,ENST00000452771.5,ENST00000413910.5,ENST00000369550.10 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID | 29072297 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1