Details of RNA Modification Site of hg38
mod ID m5C_site_23957 mod Site chr19:34400838-34400839:+
mod Type m5C Sequence GGTTCAAGCTATTCTCCTGCCTCAGCCTCCCGAGTAGCTGG
Motif Score noScore
RNA Structure Motif ..((.........))(((........)))..
MFE -1.60
Support Dataset Num 1 Support sub-Dataset Num 1
Support Dataset List GSE133623
Support sub-Dataset List GSM3913396
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000606020.1,ENST00000415930.8,ENST00000592740.5,ENST00000644934.1,ENST00000356487.11
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000606020.1ENSG00000266953.6AC092073.1protein_codingintron-1
ENST00000415930.8ENSG00000105220.16GPIprotein_codingutr3-19
ENST00000592740.5ENSG00000266953.6AC092073.1protein_codingintron-2
ENST00000644934.1ENSG00000105220.16GPIprotein_codingutr3-18
ENST00000356487.11ENSG00000105220.16GPIprotein_codingutr3-18
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID NA

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.


© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1