RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m5C_site_33207

mod Site

chr3:184318955-184318956:+

mod Type

m5C

Sequence

TGGTGATGCACTCTTGTAATCCCAGCTATTCGGGAGGCTGA

Motif Score

noScore

RNA Structure Motif

.((((....)))).((((........)))).

MFE

-5.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE133623

Support sub-Dataset List

GSM3913396

Cell/Tissue List

T24

Seq Type List

Bisulfite-seq

Transcript ID List

ENST00000444134.5,ENST00000426123.5,ENST00000392537.6,ENST00000421110.5,ENST00000414031.5,ENST00000346169.6,ENST00000450424.5,ENST00000350481.9,ENST00000427141.6,ENST00000413967.5,ENST00000342981.8,ENST00000411531.5,ENST00000352767.7,ENST00000427845.5,ENST00000440448.5,ENST00000382330.7,rmsk_1189373,ENST00000456033.5,ENST00000442406.5,ENST00000424196.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000444134.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-1
ENST00000426123.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-5
ENST00000392537.6	ENSG00000114867.20	EIF4G1	protein_coding	intron-3
ENST00000421110.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-6
ENST00000414031.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-6
ENST00000346169.6	ENSG00000114867.20	EIF4G1	protein_coding	intron-6
ENST00000450424.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-5
ENST00000350481.9	ENSG00000114867.20	EIF4G1	protein_coding	intron-2
ENST00000427141.6	ENSG00000114867.20	EIF4G1	protein_coding	intron-7
ENST00000413967.5	ENSG00000114867.20	EIF4G1	nonsense_mediated_decay	intron-4
ENST00000342981.8	ENSG00000114867.20	EIF4G1	protein_coding	intron-5
ENST00000411531.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-3
ENST00000352767.7	ENSG00000114867.20	EIF4G1	protein_coding	intron-6
ENST00000427845.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-3
ENST00000440448.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-6
ENST00000382330.7	ENSG00000114867.20	EIF4G1	protein_coding	intron-7
rmsk_1189373	rmsk_1189373	AluSz	Alu	exon
ENST00000456033.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-4
ENST00000442406.5	ENSG00000114867.20	EIF4G1	nonsense_mediated_decay	intron-2
ENST00000424196.5	ENSG00000114867.20	EIF4G1	protein_coding	intron-5

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.