RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m5C_site_5955

mod Site

chr10:112951322-112951323:+

mod Type

m5C

Sequence

CCCGGAGCCGCCCCCCGGGCCGGCCGCCCCGCGCGCCCCGG

Motif Score

noScore

RNA Structure Motif

.(((((((...))).))))(((.....))).

MFE

-12.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE133623

Support sub-Dataset List

GSM3913396

Cell/Tissue List

T24

Seq Type List

Bisulfite-seq

Transcript ID List

ENST00000369397.8,ENST00000538897.5,ENST00000534894.5,ENST00000355995.8,ENST00000542695.5,ENST00000369395.6,ENST00000346198.5,ENST00000352065.10,ENST00000536810.5,ENST00000355717.9,ENST00000629706.2,ENST00000543371.5,ENST00000545257.6,ENST00000627217.3

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000369397.8	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000538897.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000534894.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000355995.8	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000542695.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000369395.6	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000346198.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000352065.10	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000536810.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000355717.9	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000629706.2	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000543371.5	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000545257.6	ENSG00000148737.17	TCF7L2	protein_coding	intron-2
ENST00000627217.3	ENSG00000148737.17	TCF7L2	protein_coding	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.