RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_101264

mod Site

chr10:52451425-52451426:-

mod Type

m6A

Sequence

CTACGAAGACTAGCTATGGAACTTCCTACACTGAGACAACT

Motif Score

3.37338095238095

RNA Structure Motif

.....(((....(((...)))....)))...

MFE

-1.70

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125803, GSE55572

Support sub-Dataset List

GSM3582054, GSM1339427, GSM1339429

Cell/Tissue List

A549

Seq Type List

MeRIP-seq,m6A-seq

Transcript ID List

ENST00000435813.6,ENST00000422763.1,ENST00000647908.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000435813.6	ENSG00000231131.7	LNCAROD	lincRNA	exon-3
ENST00000422763.1	ENSG00000231131.7	LNCAROD	lincRNA	exon-4
ENST00000647908.1	ENSG00000231131.7	LNCAROD	lincRNA	exon-7

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31597913, 24981863

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.