| mod ID | m6A_site_103322 | mod Site | chr10:68691063-68691064:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGTACGATGCCTTCGGGAAGACTCAGTGGTGCCAATGCAGC |
||||||||
| Motif Score | 3.31938095238095 | ||||||||||
| RNA Structure Motif |
...(((...(((....)))...)))...... |
MFE | -3.80 | ||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 23 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM928399, GSM928401, GSM928403, GSM1272358, GSM1272360, GSM1272362, GSM1272366, GSM1339407, GSM2203047, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2417477, GSM2417478, GSM2417479, GSM2460354, GSM2460360, GSM2754216, GSM2464911, GSM2464913 |
||||||||||
| Cell/Tissue List |
HEK293T, H1A, H1B, fibroblasts, Huh7, Jurkat, HEK293A-TOA, MSC, TREX, iSLK, endometrial |
||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | ||||||||||
| Transcript ID List | ENST00000373644.5 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | susScr11:m6A_site_43089 | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1