RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_109524

mod Site

chr10:88991310-88991311:+

mod Type

m6A

Sequence

GAGAGGAGCGGAACTCCTGGACAAGCCCTGACAAGCCAAGC

Motif Score

3.64304761904762

RNA Structure Motif

(((.....)))..((......))........

MFE

-1.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE125803, GSE74016, GSE93676, GSE97408

Support sub-Dataset List

GSM2739523, GSM2739535, GSM2987449, GSM3582046, GSM1908208, GSM2460354, GSM2564019

Cell/Tissue List

HeLa, HepG2, MT4, MSC, NB4

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000479522.5,ENST00000313771.9,ENST00000494410.5,ENST00000357339.6,ENST00000460510.5,ENST00000492756.5,ENST00000355740.7,ENST00000477270.5,ENST00000352159.8,ENST00000488877.5,ENST00000484444.5,ENST00000355279.2,ENST00000612663.5,ENST00000652046.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000479522.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000313771.9	ENSG00000026103.22	FAS	processed_transcript	exon-1
ENST00000494410.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000357339.6	ENSG00000026103.22	FAS	protein_coding	intron-1
ENST00000460510.5	ENSG00000026103.22	FAS	processed_transcript	exon-1
ENST00000492756.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000355740.7	ENSG00000026103.22	FAS	protein_coding	intron-1
ENST00000477270.5	ENSG00000026103.22	FAS	processed_transcript	intron-1
ENST00000352159.8	ENSG00000026103.22	FAS	protein_coding	intron-1
ENST00000488877.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000484444.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000355279.2	ENSG00000026103.22	FAS	protein_coding	intron-1
ENST00000612663.5	ENSG00000026103.22	FAS	nonsense_mediated_decay	intron-1
ENST00000652046.1	ENSG00000026103.22	FAS	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31597913, 27572442, 29109479, 29290617

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.