RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_121224

mod Site

chr10:121565596-121565597:-

mod Type

m6A

Sequence

ATGCCGCCGTGATCAGTTGGACTAAGGATGGGGTGCACTTG

Motif Score

4.06504166666667

RNA Structure Motif

(((.(.(((..(......)..))).))))..

MFE

-3.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE55572, GSE90914

Support sub-Dataset List

GSM1339393, GSM1339395, GSM2417477

Cell/Tissue List

hNPCs, hESCs, HEK293A-TOA

Seq Type List

m6A-seq

Transcript ID List

ENST00000358487.9,ENST00000613324.4,ENST00000457416.6,ENST00000356226.8,ENST00000369061.8,ENST00000346997.6,ENST00000369060.8,ENST00000604236.5,ENST00000357555.9,ENST00000369059.5,ENST00000369056.5,ENST00000613048.4,ENST00000490349.5,ENST00000491475.1,ENST00000369058.7,ENST00000359354.6,ENST00000360144.7,ENST00000636922.1,ENST00000351936.10,ENST00000336553.10,ENST00000611527.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000358487.9	ENSG00000066468.22	FGFR2	protein_coding	cds-3
ENST00000613324.4	ENSG00000066468.22	FGFR2	protein_coding	cds-2
ENST00000457416.6	ENSG00000066468.22	FGFR2	protein_coding	cds-3
ENST00000356226.8	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000369061.8	ENSG00000066468.22	FGFR2	protein_coding	cds-2
ENST00000346997.6	ENSG00000066468.22	FGFR2	protein_coding	cds-2
ENST00000369060.8	ENSG00000066468.22	FGFR2	protein_coding	cds-3
ENST00000604236.5	ENSG00000066468.22	FGFR2	nonsense_mediated_decay	intron-2
ENST00000357555.9	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000369059.5	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000369056.5	ENSG00000066468.22	FGFR2	protein_coding	cds-2
ENST00000613048.4	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000490349.5	ENSG00000066468.22	FGFR2	processed_transcript	exon-3
ENST00000491475.1	ENSG00000066468.22	FGFR2	retained_intron	exon-1
ENST00000369058.7	ENSG00000066468.22	FGFR2	protein_coding	cds-3
ENST00000359354.6	ENSG00000066468.22	FGFR2	protein_coding	cds-3
ENST00000360144.7	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000636922.1	ENSG00000066468.22	FGFR2	non_stop_decay	intron-3
ENST00000351936.10	ENSG00000066468.22	FGFR2	protein_coding	cds-2
ENST00000336553.10	ENSG00000066468.22	FGFR2	protein_coding	intron-2
ENST00000611527.1	ENSG00000066468.22	FGFR2	protein_coding	intron-1

Conserved Sites

mm10:m6A_site_573595

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

24981863, 28525753

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.