| mod ID | m6A_site_125588 | mod Site | chr11:533894-533895:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....(((((....)).)))............ |
MFE | -3.00 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 2 | Support sub-Dataset Num | 2 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE120229, GSE129842 | |||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List | GSM3396437, GSE129842 | |||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | HEK293T, hESC-HEK293T | |||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | MeRIP-seq,MAZTER-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000311189.8,ENST00000468682.2,ENST00000417302.5,ENST00000479482.1,ENST00000397596.6,ENST00000451590.5,ENST00000493230.5,ENST00000397594.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_576737;susScr11:m6A_site_61813 | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | METTL3 | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 31257032 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1