| mod ID | m6A_site_128645 | mod Site | chr11:5680203-5680204:- | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GAGGAACCTCAGCAGCCAGGACAGGCAGGAGCAGTGGAATA |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..(((....(((......)))..)))..... |
MFE | -5.60 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 40 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3396437, GSM3582052, GSM3582054, GSM1166139, GSM1166140, GSM1166143, GSM1339425, GSM1339427, GSM1339429, GSM1594131, GSM2283210, GSM2283211, GSM2283212, GSM2283214, GSM2283215, GSM2324298, GSM2324310, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754214, GSM2754216, GSM2754238, GSM2754240, GSM2464907, GSM2464911, GSM2464913, GSM2464931 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, U2OS, GM12878, Jurkat, CD4T, peripheral-blood, HEK293A-TOA, iSLK, MSC, TIME, endometrial, HEC-1-A |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000396847.7,ENST00000380027.5,ENST00000380034.7,ENST00000419850.1,ENST00000433961.5,ENST00000412903.1 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_11057 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1