| mod ID | m6A_site_129271 | mod Site | chr11:6604250-6604251:+ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AGGCTTCCCCAATCCAGGGGACTCGGCGCCGGGACGCTGCT |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((((......)))))((((....))))... |
MFE | -11.40 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 6 | Support sub-Dataset Num | 18 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2987447, GSM2203047, GSM2203051, GSM2324298, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464923, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HepG2, Huh7, peripheral-blood, HEK293T, endometrial, MM6 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000527121.5,ENST00000534565.1,ENST00000526711.5,ENST00000420936.6,ENST00000532063.5,ENST00000537806.5,ENST00000530016.5,ENST00000526114.5,ENST00000299421.8,ENST00000528995.5,ENST00000396751.6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1