| mod ID | m6A_site_129310 | mod Site | chr11:6609356-6609357:+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GAAGGTGCTGAAGGTTCGAGACTGGAGTACAAGGAAGAGCA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((..((........))..))))....... |
MFE | -3.20 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 2 | Support sub-Dataset Num | 7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE110320, GSE93911 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2987447, GSM2464907, GSM2464909, GSM2464911, GSM2464915, GSM2464917, GSM2464919 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | HepG2, endometrial | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000527121.5,ENST00000420936.6,ENST00000299421.8,ENST00000537806.5,ENST00000528995.5,ENST00000396751.6,ENST00000528784.5,ENST00000534706.1,ENST00000532063.5,ENST00000526711.5,ENST00000530016.5,ENST00000526318.2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 3086759, 30154548 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1