Details of RNA Modification Site of hg38
mod ID m6A_site_13519 mod Site chr1:22914849-22914850:+
mod Type m6A Sequence GAGGAGCTTCCCACTCCAGGACTGTTGATGAAAGGGACAGA
Motif Score 4.06504166666667
RNA Structure Motif ....(((..(((((.....)))..))..)))
 MFE -2.60
Support Dataset Num 8 Support sub-Dataset Num 27
Support Dataset List
Support sub-Dataset List

GSM2739507, GSM2739522, GSM2739535, GSM2991403, GSM3396438, GSM3582052, GSM3582053, GSM3582054, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339395, GSM1339425, GSM1339427, GSM2332975, GSM2332977, GSM2332978, GSM2417477, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460358, GSM2754237
Cell/Tissue List

HeLa, HEK293T, A549, H1B, H1A, hESCs, GSC-11, HEK293A-TOA, iSLK, TIME
Seq Type List m6A-seq,MeRIP-seq
Transcript ID List ENST00000400191.7
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000400191.7ENSG00000133216.16EPHB2protein_codingutr3-17
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1