RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_135650

mod Site

chr11:31810530-31810531:-

mod Type

m6A

Sequence

AGCTCGCGGGAAGAAGGGAGACTCCAGGCGCGACAGCAGCC

Motif Score

3.31938095238095

RNA Structure Motif

((((((...........)))...))).....

MFE

-3.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE87515, GSE87516, GSE90914

Support sub-Dataset List

GSM2739535, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479

Cell/Tissue List

HeLa, GSC-11, HEK293T, HEK293A-TOA

Seq Type List

m6A-seq

Transcript ID List

ENST00000640975.1,ENST00000527769.5,ENST00000638913.1,ENST00000638250.1,ENST00000638685.1,ENST00000640242.1,ENST00000640431.1,ENST00000379109.7,ENST00000645710.1,ENST00000606377.6,ENST00000379115.9,ENST00000638965.1,ENST00000379132.8,ENST00000640172.1,ENST00000640684.1,ENST00000639054.1,ENST00000640251.1,ENST00000533333.5,ENST00000639950.1,ENST00000379129.7,ENST00000640617.1,ENST00000474783.2,ENST00000438681.6,ENST00000640613.1,ENST00000639916.1,ENST00000639409.1,ENST00000379111.7,ENST00000423822.7,ENST00000640368.1,ENST00000241001.13,ENST00000638903.1,ENST00000419022.6,ENST00000471303.6,ENST00000639034.2,ENST00000639394.1,ENST00000643871.1,ENST00000524853.6,ENST00000525535.2,ENST00000638914.2,ENST00000640610.1,ENST00000379123.10,ENST00000455099.6,ENST00000532175.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000640975.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000527769.5	ENSG00000007372.22	PAX6	retained_intron	intron-1
ENST00000638913.1	ENSG00000007372.22	PAX6	retained_intron	intron-2
ENST00000638250.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000638685.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000640242.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000640431.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000379109.7	ENSG00000007372.22	PAX6	protein_coding	utr5-1
ENST00000645710.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000606377.6	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000379115.9	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000638965.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000379132.8	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000640172.1	ENSG00000007372.22	PAX6	retained_intron	intron-2
ENST00000640684.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000639054.1	ENSG00000007372.22	PAX6	retained_intron	intron-1
ENST00000640251.1	ENSG00000007372.22	PAX6	processed_transcript	intron-1
ENST00000533333.5	ENSG00000007372.22	PAX6	retained_intron	intron-2
ENST00000639950.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000379129.7	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000640617.1	ENSG00000007372.22	PAX6	processed_transcript	exon-2
ENST00000474783.2	ENSG00000007372.22	PAX6	retained_intron	intron-2
ENST00000438681.6	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000640613.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000639916.1	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000639409.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000379111.7	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000423822.7	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000640368.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000241001.13	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000638903.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000419022.6	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000471303.6	ENSG00000007372.22	PAX6	retained_intron	intron-1
ENST00000639034.2	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000639394.1	ENSG00000007372.22	PAX6	nonsense_mediated_decay	intron-1
ENST00000643871.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000524853.6	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000525535.2	ENSG00000007372.22	PAX6	protein_coding	intron-1
ENST00000638914.2	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000640610.1	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000379123.10	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000455099.6	ENSG00000007372.22	PAX6	protein_coding	intron-2
ENST00000532175.5	ENSG00000007372.22	PAX6	retained_intron	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 28344040, 27773536, 28525753

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.