| mod ID | m6A_site_137308 | mod Site | chr11:35229396-35229397:+ | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AACCATTACAGGGAGCTGGGACACTTAACAGATGCAATGTG |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...(((....))).................. |
MFE | -2.40 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 18 | Support sub-Dataset Num | 71 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991416, GSM3582048, GSM3582049, GSM3582052, GSM3582054, GSE129842, GSM908335, GSM1135032, GSM1135033, GSM1339395, GSM1339403, GSM1339405, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM1828596, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2203060, GSM2203064, GSM2283214, GSM2283215, GSM2324292, GSM2324298, GSM2324304, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2754211, GSM2754220, GSM2754222, GSM2754224, GSM2754237, GSM2754244, GSM2754246, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464927, GSM2464931, GSM2564019, GSM2602072 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, A549, hESC-HEK293T, HepG2, hESCs, fibroblasts, LCLs, CD8T, H1299, MM6, Huh7, CD4T, peripheral-blood, GSC-11, iSLK, MSC, TIME, endometrial, HEC-1-A, NB4, AML |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq,m6A-CLIP/IP,miCLIP | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000415148.6,ENST00000425428.6,ENST00000526669.6,ENST00000263398.10,ENST00000527326.1,ENST00000434472.6,ENST00000428726.7,ENST00000433892.6,ENST00000525469.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_346493;panTro5:m6A_site_11666;rn6:m6A_site_65847;susScr11:m6A_site_65973 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1