RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_143557

mod Site

chr11:61967163-61967164:-

mod Type

m6A

Sequence

GCTGCTCGAGGTTTCCGAGGACTTCTCTGGCGCAGAAAGTC

Motif Score

4.06504166666667

RNA Structure Motif

..(((((((....)))))))((((...))))

MFE

-5.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE120229, GSE125803, GSE37002, GSE48037, GSE70299, GSE74016, GSE76367, GSE76414, GSE83438, GSE85724, GSE87515, GSE93676, GSE93911, GSE94808, GSE97408

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2991403, GSM2987447, GSM2987449, GSM3396437, GSM3396438, GSM3582046, GSM3582048, GSM3582052, GSM3582053, GSM3582054, GSM908331, GSM1166139, GSM1166143, GSM1166144, GSM1723349, GSM1723351, GSM1908206, GSM1908210, GSM1982257, GSM2010456, GSM2203047, GSM2203051, GSM2283210, GSM2283211, GSM2283214, GSM2332977, GSM2332978, GSM2460345, GSM2460352, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464931, GSM2483505, GSM2564019, GSM2564022

Cell/Tissue List

HeLa, HepG2, HEK293T, A549, U2OS, LCLs, MT4, MM6, Huh7, Jurkat, CD4T, GSC-11, iSLK, MSC, TIME, HEC-1-A, GSCs, NB4

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000529548.1,ENST00000529191.5,ENST00000620041.4,ENST00000526640.5,ENST00000532829.5,ENST00000534719.1,ENST00000533138.1,ENST00000534180.1,ENST00000532601.1,ENST00000530019.5,ENST00000273550.12,ENST00000529631.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000529548.1	ENSG00000167996.16	FTH1	protein_coding	intron-2
ENST00000529191.5	ENSG00000167996.16	FTH1	protein_coding	intron-1
ENST00000620041.4	ENSG00000167996.16	FTH1	protein_coding	intron-2
ENST00000526640.5	ENSG00000167996.16	FTH1	protein_coding	intron-1
ENST00000532829.5	ENSG00000167996.16	FTH1	nonsense_mediated_decay	intron-1
ENST00000534719.1	ENSG00000167996.16	FTH1	retained_intron	intron-1
ENST00000533138.1	ENSG00000167996.16	FTH1	retained_intron	intron-1
ENST00000534180.1	ENSG00000167996.16	FTH1	nonsense_mediated_decay	intron-1
ENST00000532601.1	ENSG00000167996.16	FTH1	protein_coding	utr5-1
ENST00000530019.5	ENSG00000167996.16	FTH1	protein_coding	intron-1
ENST00000273550.12	ENSG00000167996.16	FTH1	protein_coding	intron-1
ENST00000529631.5	ENSG00000167996.16	FTH1	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31597913, 22575960, 24209618, 27773535, 27572442, 27117702, 28017614, 27371828, 28344040, 29109479, 30154548, 28297667, 29290617

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.