| mod ID | m6A_site_144011 | mod Site | chr11:62532241-62532242:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTACCAAAGCTGGAAGGAGAACTCAAAGGCCCAAAAGTGGA |
|||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||
| RNA Structure Motif |
...(((...((.....))....)))...... |
MFE | -2.30 | |||||||||||||||||||||||
| Support Dataset Num | 17 | Support sub-Dataset Num | 67 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM908331, GSM908333, GSM908335, GSM908337, GSM1135020, GSM1135032, GSM1135033, GSM1166140, GSM1166141, GSM1339393, GSM1339401, GSM1339405, GSM1339427, GSM1982263, GSM2010454, GSM2010456, GSM2283211, GSM2283212, GSM2283213, GSM2324298, GSM2324310, GSM2417477, GSM2417478, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754211, GSM2754220, GSM2754222, GSM2754224, GSM2754235, GSM2754237, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464931, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, HepG2, U2OS, hNPCs, fibroblasts, A549, H1299, MM6, Jurkat, peripheral-blood, HEK293A-TOA, iSLK, MSC, TIME, endometrial, HEC-1-A, NB4 |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000530124.5,ENST00000378024.9,ENST00000533365.5,ENST00000257247.11 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_307345;rn6:m6A_site_10811 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1