RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_145072

mod Site

chr11:62855345-62855346:-

mod Type

m6A

Sequence

CTACGGGGATGATTTTACGAACTGAACTCTCTCTTTCTGAT

Motif Score

3.37338095238095

RNA Structure Motif

((((.((.((((.....)))).))))))...

MFE

-3.70

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE133132, GSE98623

Support sub-Dataset List

GSM2991416, GSM3900734, GSM2602071

Cell/Tissue List

HeLa, BGC823, AML

Seq Type List

m6A-seq,miCLIP

Transcript ID List

ENST00000537024.5,ENST00000545308.5,ENST00000537925.5,ENST00000538266.5,ENST00000537068.5,ENST00000541578.5,ENST00000540865.5,ENST00000544550.5,ENST00000384147.1,ENST00000544983.1,ENST00000540725.5,ENST00000541416.5,ENST00000537965.5,ENST00000538654.5,ENST00000540904.1,ENST00000537869.5,ENST00000535689.5,ENST00000545440.5,ENST00000545688.5,ENST00000541615.5,ENST00000542112.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000537024.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000545308.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000537925.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000538266.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000537068.5	ENSG00000255717.6	SNHG1	lincRNA	intron-2
ENST00000541578.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000540865.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000544550.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000384147.1	ENSG00000276788.1	SNORD26	snoRNA	exon-1
ENST00000544983.1	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000540725.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000541416.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000537965.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000538654.5	ENSG00000255717.6	SNHG1	retained_intron	exon-1
ENST00000540904.1	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000537869.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000535689.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000545440.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000545688.5	ENSG00000255717.6	SNHG1	retained_intron	intron-1
ENST00000541615.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1
ENST00000542112.5	ENSG00000255717.6	SNHG1	lincRNA	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

METTL14,WTAP

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
METTL14	METTL14:CH1534	chr11:62855328-62855347	SBDH142-638
WTAP	WTAP:CH2028	chr11:62855325-62855347	SBDH141-1161

PubMed ID

29507755, 31607270, 28920958

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.