RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_145100

mod Site

chr11:62884508-62884509:+

mod Type

m6A

Sequence

GGATGGGTTCCAGGTTCGGGACATAGAGAATCTGAAGGTGA

Motif Score

3.64304761904762

RNA Structure Motif

.....(((((((..........)))))))..

MFE

-7.70

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE129842, GSE83438

Support sub-Dataset List

GSE129842, GSM2203048

Cell/Tissue List

hESC-HEK293T, Huh7

Seq Type List

MAZTER-seq,MeRIP-seq

Transcript ID List

ENST00000377890.6,ENST00000338663.11,ENST00000546253.5,ENST00000535296.5,ENST00000546312.5,ENST00000536981.5,ENST00000535768.1,ENST00000541425.5,ENST00000457660.6,ENST00000377889.6,ENST00000538682.5,ENST00000542922.5,ENST00000377891.6,ENST00000537508.5,ENST00000539891.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000377890.6	ENSG00000168003.16	SLC3A2	protein_coding	cds-7
ENST00000338663.11	ENSG00000168003.16	SLC3A2	protein_coding	cds-4
ENST00000546253.5	ENSG00000168003.16	SLC3A2	processed_transcript	exon-4
ENST00000535296.5	ENSG00000168003.16	SLC3A2	protein_coding	cds-6
ENST00000546312.5	ENSG00000168003.16	SLC3A2	retained_intron	exon-2
ENST00000536981.5	ENSG00000168003.16	SLC3A2	protein_coding	utr5-3
ENST00000535768.1	ENSG00000168003.16	SLC3A2	retained_intron	exon-1
ENST00000541425.5	ENSG00000168003.16	SLC3A2	nonsense_mediated_decay	utr3-3
ENST00000457660.6	ENSG00000168003.16	SLC3A2	processed_transcript	exon-3
ENST00000377889.6	ENSG00000168003.16	SLC3A2	protein_coding	cds-5
ENST00000538682.5	ENSG00000168003.16	SLC3A2	processed_transcript	exon-4
ENST00000542922.5	ENSG00000168003.16	SLC3A2	retained_intron	exon-1
ENST00000377891.6	ENSG00000168003.16	SLC3A2	protein_coding	cds-7
ENST00000537508.5	ENSG00000168003.16	SLC3A2	processed_transcript	exon-4
ENST00000539891.5	ENSG00000168003.16	SLC3A2	protein_coding	utr5-5

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH14256	chr11:62884470-62884511	SBDH828-3856

PubMed ID

31257032, 27773535

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.