| mod ID | m6A_site_147703 | mod Site | chr11:65423597-65423598:+ | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
ACGCTGCTCGGGTGTTGGGGACAACATTGACCAACGCTTTA |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....((((((((....))))))...)).... |
MFE | -6.70 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 29 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2991403, GSM2884199, GSM2987447, GSM2987448, GSM3396438, GSM908331, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1339425, GSM2203052, GSM2324298, GSM2324306, GSM2324310, GSM2332990, GSM2460362, GSM2464909, GSM2464911, GSM2464915, GSM2464917, GSM2464919, GSM2464931 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, U2OS, A549, Huh7, peripheral-blood, TREX, endometrial, HEC-1-A |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000601801.3,ENST00000646243.1,ENST00000501122.2,ENST00000499732.3,ENST00000612303.2,ENST00000642367.1,ENST00000645023.1 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1