Details of RNA Modification Site of hg38
mod ID m6A_site_148038 mod Site chr11:65504633-65504634:+
mod Type m6A Sequence ATTTCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTC
Motif Score 4.06504166666667
RNA Structure Motif ....(((...((....))...))).......
MFE -4.60
Support Dataset Num 2 Support sub-Dataset Num 2
Support Dataset List GSE102493GSE107954
Support sub-Dataset List GSM2991416, GSM2884197
Cell/Tissue List HeLa, CD34
Seq Type List m6A-seq
Transcript ID List ENST00000619449.2,ENST00000610851.1,ENST00000613376.1,ENST00000612781.1,ENST00000618132.1,ENST00000534336.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000619449.2ENSG00000251562.8MALAT1lincRNAintron-3
ENST00000610851.1ENSG00000251562.8MALAT1lincRNAexon-1
ENST00000613376.1ENSG00000251562.8MALAT1lincRNAintron-1
ENST00000612781.1ENSG00000251562.8MALAT1lincRNAintron-3
ENST00000618132.1ENSG00000251562.8MALAT1lincRNAexon-2
ENST00000534336.1ENSG00000251562.8MALAT1lincRNAexon-1
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 1 Writer Name List RBM15B
Writer Catalysis Detail

Writer Name Writer ID Writer Binding Site Source
RBM15BRBM15B:CH37892chr11:65504569-65504689SBDH685-37892
PubMed ID 2950775530065315

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.


© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1