RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_165082

mod Site

chr11:117289175-117289176:+

mod Type

m6A

Sequence

TCTGCCAGGGTACCACAGGGACACACGCCAAGGTAACCTGC

Motif Score

3.64304761904762

RNA Structure Motif

.....((((...((........))..)))).

MFE

-4.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE120229, GSE29714, GSE46705, GSE55572, GSE83438, GSE90914, GSE93676

Support sub-Dataset List

GSM2739506, GSM2991403, GSM3396438, GSM928399, GSM1135032, GSM1135033, GSM1339425, GSM2203060, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2460347, GSM2460352, GSM2460354, GSM2460358, GSM2460360, GSM2754220, GSM2754235, GSM2754237, GSM2754244

Cell/Tissue List

HeLa, HEK293T, A549, Huh7, HEK293A-TOA, iSLK, MSC, TIME, TREX

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000649580.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000649580.1	ENSG00000278768.2	BACE1-AS	retained_intron	exon-1

Conserved Sites

mm10:m6A_site_626554

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 22608085, 24284625, 24981863, 27773535, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.