Details of RNA Modification Site of hg38
mod ID m6A_site_172813 mod Site chr12:2858228-2858229:-
mod Type m6A Sequence CCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGA
Motif Score 3.31938095238095
RNA Structure Motif ................(((((....))))).
 MFE -5.10
Support Dataset Num 5 Support sub-Dataset Num 13
Support Dataset List
Support sub-Dataset List

GSM928399, GSM928401, GSM908337, GSM1135032, GSM1135033, GSM1339395, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM2460347, GSM2460358
Cell/Tissue List

HEK293T, HepG2, HeLa, hESCs, fibroblasts, A549, iSLK, TIME
Seq Type List MeRIP-seq,m6A-seq
Transcript ID List ENST00000342628.6,ENST00000627656.2,ENST00000361953.7,ENST00000359843.7,ENST00000536066.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000342628.6ENSG00000111206.12FOXM1protein_codingutr3-10
ENST00000627656.2ENSG00000111206.12FOXM1protein_codingutr3-8
ENST00000361953.7ENSG00000111206.12FOXM1protein_codingutr3-8
ENST00000359843.7ENSG00000111206.12FOXM1protein_codingutr3-9
ENST00000536066.1ENSG00000111206.12FOXM1retained_intronexon-2
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 1 Writer Name List METTL14
Writer Catalysis Detail

Writer Name Writer ID Writer Binding Site Source
METTL14METTL14:CH1867chr12:2858224-2858256SBDH141-1401
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1