| mod ID | m6A_site_172876 | mod Site | chr12:2872167-2872168:- | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CGAAAGATGAGTTCTGATGGACTGGGCTCCCGCAGCATCAA |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...((((((.........))))))....... |
MFE | -5.50 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 19 | Support sub-Dataset Num | 58 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM3582054, GSM928399, GSM928403, GSM908331, GSM1135020, GSM1166140, GSM1166141, GSM1272366, GSM1272368, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2203043, GSM2203047, GSM2203051, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283215, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2332978, GSM2460345, GSM2460347, GSM2460348, GSM2460352, GSM2460360, GSM2754211, GSM2754226, GSM2754235, GSM2754246, GSM2464905, GSM2464907, GSM2464909, GSM2464913, GSM2464931, GSM2483505, GSM2564019, GSM2564022 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, A549, U2OS, H1A, H1B, H1299, MM6, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, iSLK, MSC, TREX, TIME, endometrial, HEC-1-A, GSCs, NB4 |
||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000359843.7,ENST00000342628.6,ENST00000545049.1,ENST00000537018.5,ENST00000627656.2,ENST00000538564.5,ENST00000361953.7 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1