RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_173857

mod Site

chr12:6330478-6330479:-

mod Type

m6A

Sequence

CTCAGTTCATACCGCTGGGGACTCTGGGCAGAAGGTGGCCC

Motif Score

4.06504166666667

RNA Structure Motif

.....((((((.((....)).)))....)))

MFE

-5.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954, GSE46705, GSE83438

Support sub-Dataset List

GSM2884197, GSM1135020, GSM2203043, GSM2203047

Cell/Tissue List

CD34, HeLa, Huh7

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000543359.5,ENST00000536717.5,ENST00000543995.5,ENST00000540022.5,ENST00000162749.6,ENST00000535038.1,ENST00000534885.5,ENST00000539372.5,ENST00000537842.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000543359.5	ENSG00000067182.7	TNFRSF1A	processed_transcript	intron-2
ENST00000536717.5	ENSG00000067182.7	TNFRSF1A	retained_intron	intron-2
ENST00000543995.5	ENSG00000067182.7	TNFRSF1A	nonsense_mediated_decay	intron-6
ENST00000540022.5	ENSG00000067182.7	TNFRSF1A	protein_coding	intron-6
ENST00000162749.6	ENSG00000067182.7	TNFRSF1A	protein_coding	intron-7
ENST00000535038.1	ENSG00000067182.7	TNFRSF1A	processed_transcript	intron-1
ENST00000534885.5	ENSG00000067182.7	TNFRSF1A	nonsense_mediated_decay	intron-6
ENST00000539372.5	ENSG00000067182.7	TNFRSF1A	protein_coding	cds-7
ENST00000537842.5	ENSG00000067182.7	TNFRSF1A	processed_transcript	intron-4

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

30065315, 24284625, 27773535

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.