| mod ID | m6A_site_18005 | mod Site | chr1:28742539-28742540:+ | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCC |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((.(((((...))).)).))))....... |
MFE | -1.40 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 31 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSE125240, GSE129842, GSM928399, GSM928401, GSM908333, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166144, GSM1339395, GSM1339401, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM2417477, GSM2417478, GSM2417479, GSM2460347, GSM2602070 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
CD34, HEK293T, hESC-HEK293T, HepG2, HeLa, U2OS, hESCs, fibroblasts, A549, GM12878, HEK293A-TOA, iSLK, AML |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-REF-seq,MAZTER-seq,miCLIP | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000373812.8,ENST00000476976.1,ENST00000496288.5,ENST00000474884.5,ENST00000541996.5,ENST00000468863.1,ENST00000542507.5,ENST00000478283.5,ENST00000475796.5 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_435590 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15B | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1