| mod ID | m6A_site_18060 | mod Site | chr1:28769031-28769032:+ | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGACCTTCAAGAGAATTAGGACTTTTTTCTTAATTTCACTG |
|||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||
| RNA Structure Motif |
.......(((((((((......))))))))) |
MFE | -5.20 | |||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 49 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2739522, GSM2739523, GSM2991403, GSM2991416, GSM2884195, GSM2987449, GSM3396437, GSM3396438, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM928403, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM2010454, GSM2203052, GSM2203060, GSM2203063, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754213, GSM2754220, GSM2754224, GSM2754226, GSM2754237, GSM2754240, GSM2754248 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, hNPCs, hESCs, fibroblasts, A549, GM12878, MM6, Huh7, HEK293A-TOA, iSLK, MSC, TIME, TREX |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000373812.8,ENST00000541996.5,ENST00000542507.5,ENST00000478283.5 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_435564;rheMac8:m6A_site_1449;rn6:m6A_site_80819;susScr11:m6A_site_114594 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | |||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1