RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_185352

mod Site

chr12:48125374-48125375:+

mod Type

m6A

Sequence

CTCACACCTGTAATCCCAGGACTTTGGGAGGCCGAGGCGGG

Motif Score

4.06504166666667

RNA Structure Motif

..(.((..((((((....)))))).)).)..

MFE

-7.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE125803

Support sub-Dataset List

GSM2739503, GSM2991400, GSM3582048

Cell/Tissue List

HeLa

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

rmsk_3781587,ENST00000548720.5,ENST00000546465.1,ENST00000550257.6,ENST00000551804.5,ENST00000551548.5,ENST00000552989.5,ENST00000546964.5,ENST00000550345.6,ENST00000547581.5,ENST00000548345.5,ENST00000551339.6,ENST00000549022.5,ENST00000552792.5,ENST00000340802.12,ENST00000359794.11,ENST00000642730.1,ENST00000312352.11,ENST00000550924.6,ENST00000549941.7,ENST00000629846.2,ENST00000549366.5,ENST00000549003.5,ENST00000547066.5,ENST00000551485.5,ENST00000547587.5,ENST00000548288.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
rmsk_3781587	rmsk_3781587	AluSp	Alu	exon
ENST00000548720.5	ENSG00000152556.17	PFKM	retained_intron	intron-2
ENST00000546465.1	ENSG00000152556.17	PFKM	protein_coding	intron-1
ENST00000550257.6	ENSG00000152556.17	PFKM	protein_coding	intron-3
ENST00000551804.5	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000551548.5	ENSG00000152556.17	PFKM	processed_transcript	intron-2
ENST00000552989.5	ENSG00000152556.17	PFKM	nonsense_mediated_decay	intron-2
ENST00000546964.5	ENSG00000152556.17	PFKM	retained_intron	intron-2
ENST00000550345.6	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000547581.5	ENSG00000152556.17	PFKM	nonsense_mediated_decay	cds-6
ENST00000548345.5	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000551339.6	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000549022.5	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000552792.5	ENSG00000152556.17	PFKM	protein_coding	intron-4
ENST00000340802.12	ENSG00000152556.17	PFKM	protein_coding	intron-4
ENST00000359794.11	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000642730.1	ENSG00000152556.17	PFKM	protein_coding	intron-5
ENST00000312352.11	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000550924.6	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000549941.7	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000629846.2	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000549366.5	ENSG00000152556.17	PFKM	protein_coding	intron-5
ENST00000549003.5	ENSG00000152556.17	PFKM	protein_coding	intron-2
ENST00000547066.5	ENSG00000152556.17	PFKM	nonsense_mediated_decay	cds-3
ENST00000551485.5	ENSG00000152556.17	PFKM	nonsense_mediated_decay	intron-2
ENST00000547587.5	ENSG00000152556.17	PFKM	protein_coding	intron-1
ENST00000548288.5	ENSG00000152556.17	PFKM	protein_coding	intron-4

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.