RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_187211

mod Site

chr12:49741710-49741711:+

mod Type

m6A

Sequence

GCAGTAGCTTCCTTCTGCGGACAGATGGCACCCTGAAGGAA

Motif Score

3.64304761904762

RNA Structure Motif

.....((.((((....)))).))........

MFE

-5.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE83438, GSE90914, GSE93676

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739534, GSM2739535, GSM2991403, GSM2203060, GSM2417477, GSM2417478, GSM2417479, GSM2460358, GSM2754214

Cell/Tissue List

HeLa, Huh7, HEK293A-TOA, TIME, iSLK

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000547187.5,ENST00000546796.5,ENST00000546885.5,ENST00000548201.5,ENST00000549445.5,ENST00000551154.5,ENST00000549385.5,ENST00000548894.5,ENST00000267115.10,ENST00000548713.5,ENST00000547832.5,ENST00000550951.5,ENST00000549966.5,ENST00000552699.5,ENST00000546914.5,ENST00000548809.5,ENST00000552635.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000547187.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000546796.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000546885.5	ENSG00000139644.13	TMBIM6	retained_intron	intron-1
ENST00000548201.5	ENSG00000139644.13	TMBIM6	protein_coding	utr5-1
ENST00000549445.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000551154.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-2
ENST00000549385.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000548894.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000267115.10	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000548713.5	ENSG00000139644.13	TMBIM6	protein_coding	utr5-1
ENST00000547832.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000550951.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000549966.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000552699.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000546914.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-1
ENST00000548809.5	ENSG00000139644.13	TMBIM6	protein_coding	intron-3
ENST00000552635.5	ENSG00000139644.13	TMBIM6	nonsense_mediated_decay	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 27773535, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.