RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_187523

mod Site

chr12:50017002-50017003:-

mod Type

m6A

Sequence

GGTCAGTCACTTGCTAATGAACTGACATGCTCTTTCCTATT

Motif Score

3.37338095238095

RNA Structure Motif

((((.((.......)).))))..........

MFE

-2.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2739535, GSM2991403

Cell/Tissue List

HeLa

Seq Type List

m6A-seq

Transcript ID List

ENST00000427314.6,ENST00000551876.5,ENST00000547905.5,ENST00000546595.5,ENST00000552004.2,ENST00000548644.5,ENST00000546723.5,ENST00000548824.5,ENST00000312377.10,ENST00000454520.6,ENST00000552921.5,ENST00000548247.1,ENST00000548598.5,ENST00000549777.5,ENST00000548320.5,ENST00000546764.5,ENST00000552157.5,ENST00000551145.5,ENST00000552310.5,ENST00000546786.5,ENST00000550651.5,ENST00000551260.5,ENST00000550149.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000427314.6	ENSG00000161800.13	RACGAP1	protein_coding	intron-3
ENST00000551876.5	ENSG00000161800.13	RACGAP1	protein_coding	utr5-1
ENST00000547905.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-3
ENST00000546595.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000552004.2	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000548644.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000546723.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000548824.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000312377.10	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000454520.6	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000552921.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000548247.1	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000548598.5	ENSG00000161800.13	RACGAP1	nonsense_mediated_decay	intron-1
ENST00000549777.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000548320.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000546764.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000552157.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000551145.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000552310.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000546786.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1
ENST00000550651.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-2
ENST00000551260.5	ENSG00000161800.13	RACGAP1	nonsense_mediated_decay	intron-1
ENST00000550149.5	ENSG00000161800.13	RACGAP1	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.