| mod ID | m6A_site_190575 | mod Site | chr12:53711985-53711986:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTGGAGGACCACATGGATGGACACTTCTTTTTCAGCACCCA |
||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
........((((.(((....)))..)))).. |
MFE | -1.30 | ||||||||||||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 44 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2991403, GSM2991416, GSM2987449, GSM3396437, GSM3396438, GSE125240, GSM3582046, GSM3582047, GSM3582052, GSM3582053, GSM3582054, GSM928399, GSM1135032, GSM1135033, GSM1166139, GSM1339403, GSM1339405, GSM1339425, GSM1339429, GSM1339439, GSM1723351, GSM1908206, GSM1908208, GSM2010454, GSM2010456, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2464917, GSM2464919, GSM2464931, GSM2564019 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, brain, A549, U2OS, fibroblasts, LCLs, MT4, MM6, Huh7, iSLK, MSC, TIME, TREX, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-REF-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000546443.5,ENST00000430117.6,ENST00000262059.8,ENST00000548263.5,ENST00000550804.6 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_15575;rheMac8:m6A_site_11093 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1