| mod ID | m6A_site_190583 | mod Site | chr12:53712310-53712311:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGGGACTAAAGAAGAGAGGACATGGGGAACTGGAAAAATA |
||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
............................... |
MFE | 0.00 | ||||||||||||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 52 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739534, GSM2739535, GSM2991403, GSM3582046, GSM3582047, GSM928399, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339403, GSM1339405, GSM1339439, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM1908206, GSM1908210, GSM1908212, GSM2203047, GSM2203052, GSM2203056, GSM2203059, GSM2203060, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283214, GSM2283215, GSM2324310, GSM2332975, GSM2332977, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2754226, GSM2754237, GSM2464911, GSM2564019 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, H1A, H1B, hNPCs, hESCs, fibroblasts, A549, LCLs, CD8T, MT4, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, NB4 |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000546443.5,ENST00000262059.8,ENST00000548263.5,ENST00000430117.6,ENST00000550804.6 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_226496 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1