| mod ID | m6A_site_190970 | mod Site | chr12:54030102-54030103:+ | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AATTAGGGAGTCAAACGTGGACCTGAAAGTCAGCTCTGGAC |
||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
...........((.(((......))).)).. |
MFE | -2.90 | ||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 39 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739523, GSM2739535, GSM2991403, GSM3396437, GSM3396438, GSM3582053, GSM928399, GSM928401, GSM1135020, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166143, GSM1339401, GSM1339427, GSM1908208, GSM1982263, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2754220, GSM2754244 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, U2OS, MT4, H1299, Huh7, HEK293A-TOA, MSC |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000243108.5,ENST00000394331.3,ENST00000303406.4,ENST00000513209.1,ENST00000512206.1 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_226612;rn6:m6A_site_95088 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15B | ||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1