| mod ID | m6A_site_195781 | mod Site | chr12:57751662-57751663:- | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TTGGTGTCGGTGCCTATGGGACAGTGTACAAGGCCCGTGAT |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...((.((((.((..........)))))))) |
MFE | -7.10 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 6 | Support sub-Dataset Num | 8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSE125240, GSM4024128, GSE129842, GSM908331, GSM2324298, GSM2324308, GSM2324310, GSM2602072 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HEK293, HEK293T, hESC-HEK293T, HepG2, peripheral-blood, AML |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-REF-seq,DART-seq,MAZTER-seq,m6A-seq,miCLIP | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000552862.1,ENST00000257904.11,ENST00000551888.5,ENST00000550419.5,ENST00000551800.5,ENST00000552254.5,ENST00000312990.10,ENST00000553237.5,ENST00000546489.5,ENST00000547281.5,ENST00000551706.1,ENST00000549606.5,ENST00000552388.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1