| mod ID | m6A_site_197404 | mod Site | chr12:65825320-65825321:+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCGTCCACTTCAGCCCAGGGACAACCTGCCGCCCCAGCGCC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.......((.((((.....))))..)).... |
MFE | -6.20 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 28 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2987447, GSM2987448, GSM2987449, GSE129842, GSM1166139, GSM1166142, GSM1166143, GSM1166144, GSM1982263, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2754238, GSM2754244, GSM2464927, GSM2483505, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, hESC-HEK293T, U2OS, H1299, GSC-11, iSLK, MSC, HEC-1-A, GSCs, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MAZTER-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000545998.1,ENST00000537429.5,ENST00000393577.7,ENST00000537275.5,ENST00000425208.6,ENST00000393578.7,ENST00000541363.5,ENST00000536545.5,ENST00000354636.7,ENST00000403681.6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_71648 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1