| mod ID | m6A_site_201380 | mod Site | chr12:89349272-89349273:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCAGAATGTATACCAGGTGGACTCTCTGCAATCTACGTGAA |
||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||
| RNA Structure Motif |
...........(((((...)))))....... |
MFE | -2.20 | ||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 50 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM908337, GSM1272360, GSM1272368, GSM1339393, GSM1339395, GSM1339405, GSM1339407, GSM1339429, GSM1339439, GSM1982263, GSM2203043, GSM2203047, GSM2203051, GSM2203052, GSM2203056, GSM2203060, GSM2203063, GSM2203064, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754213, GSM2754214, GSM2754220, GSM2754222, GSM2754224, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464931, GSM2602070 |
||||||||||||||||||||
| Cell/Tissue List |
HEK293T, HeLa, A549, HepG2, H1B, hNPCs, hESCs, fibroblasts, H1299, Huh7, HEK293A-TOA, iSLK, MSC, TIME, HEC-1-A, AML |
||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq,miCLIP | ||||||||||||||||||||
| Transcript ID List | ENST00000547291.1,ENST00000279488.8,ENST00000308385.6 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_68535;rn6:m6A_site_90464;susScr11:m6A_site_101977 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | ||||||||||||||||||
| Writer Catalysis Detail |
|
||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1