| mod ID | m6A_site_208085 | mod Site | chr12:110281339-110281340:+ | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGC |
|||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||
| RNA Structure Motif |
(((((.((((..((...)).))))..))))) |
MFE | -12.50 | |||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 54 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2987448, GSM3582052, GSM3582053, GSM3582054, GSM908331, GSM908337, GSM1166139, GSM1166140, GSM1166143, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754226, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, A549, U2OS, hESCs, HEK293T, fibroblasts, GSC-11, HEK293A-TOA, MSC, TIME, TREX, iSLK |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000308664.10,ENST00000539276.7,ENST00000552636.1,ENST00000377685.9 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | WTAP | |||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1