| mod ID | m6A_site_21284 | mod Site | chr1:35114118-35114119:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TTTTGTAAAGAAGTAAAAGAACTCCGAAGTGCTCTAAAAAC |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...(((.(((...(.....)....)))))). |
MFE | -1.00 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 8 | Support sub-Dataset Num | 17 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM1339405, GSM1339427, GSM1828594, GSM1828596, GSM2203044, GSM2203056, GSM2203060, GSM2203063, GSM2203064, GSM2417477, GSM2417478, GSM2460347 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, fibroblasts, A549, CD8T, Huh7, HEK293A-TOA, iSLK |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000488455.5,ENST00000373330.1,ENST00000650449.1,ENST00000359858.9,ENST00000611874.4,ENST00000373329.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1