Details of RNA Modification Site of hg38
mod ID m6A_site_217855 mod Site chr12:130164511-130164512:+
mod Type m6A Sequence CCAGCGGGATGTGGATTTGGACCTCCAAGACTCTGCAGTCC
Motif Score 3.62240476190476
RNA Structure Motif .....((((((((((....)))))..)))))
 MFE -5.70
Support Dataset Num 7 Support sub-Dataset Num 23
Support Dataset List
Support sub-Dataset List

GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM928399, GSM928401, GSM928403, GSM908331, GSM908333, GSM908337, GSM1272358, GSM1272360, GSM1272364, GSM1272366, GSM1272368, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915
Cell/Tissue List

HEK293T, HeLa, HepG2, H1A, H1B, endometrial
Seq Type List MeRIP-seq,m6A-seq
Transcript ID List ENST00000229030.4,ENST00000539839.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000229030.4ENSG00000111432.4FZD10protein_codingcds-1
ENST00000539839.1ENSG00000111432.4FZD10protein_codingutr3-1
Conserved Sites mm10:m6A_site_483326;susScr11:m6A_site_39116
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1