Details of RNA Modification Site of hg38
mod ID m6A_site_21919 mod Site chr1:35738531-35738532:-
mod Type m6A Sequence GAGACTCTGATGATGATCAGACTGAAGAACAGCTTGATGAG
Motif Score 3.31938095238095
RNA Structure Motif ((((((....))))))(((.....)))....
 MFE -6.70
Support Dataset Num 8 Support sub-Dataset Num 16
Support Dataset List
Support sub-Dataset List

GSM2739534, GSM2991403, GSM1339401, GSM1339407, GSM1982263, GSM2010454, GSM2010456, GSM2203044, GSM2203047, GSM2203059, GSM2203060, GSM2203063, GSM2283211, GSM2283213, GSM2324298, GSM2464927
Cell/Tissue List

HeLa, HEK293T, fibroblasts, H1299, MM6, Huh7, Jurkat, peripheral-blood, HEC-1-A
Seq Type List m6A-seq,MeRIP-seq
Transcript ID List ENST00000373220.7,ENST00000318121.8,ENST00000520551.1,ENST00000251195.9
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000373220.7ENSG00000092853.14CLSPNprotein_codingcds-20
ENST00000318121.8ENSG00000092853.14CLSPNprotein_codingcds-21
ENST00000520551.1ENSG00000092853.14CLSPNprotein_codingcds-21
ENST00000251195.9ENSG00000092853.14CLSPNprotein_codingcds-21
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1