| mod ID | m6A_site_22013 | mod Site | chr1:35765233-35765234:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGCAGCTATGAAACAATTGGACCCTTGAGTGAAGGAGGTTT |
|||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||
| RNA Structure Motif |
.................((((.....)))). |
MFE | -3.60 | |||||||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 39 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991416, GSM2987449, GSM3396437, GSM3396438, GSM3582054, GSM928399, GSM928401, GSM1135033, GSM1166139, GSM1166143, GSM1339401, GSM2203043, GSM2203047, GSM2203055, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2283210, GSM2283212, GSM2283213, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2460345, GSM2460347, GSM2754216, GSM2754248, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, A549, U2OS, Huh7, Jurkat, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, TIME, NB4, MM6 |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000373220.7,ENST00000251195.9,ENST00000318121.8,ENST00000520551.1 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1