Details of RNA Modification Site of hg38
mod ID m6A_site_230484 mod Site chr13:71440273-71440274:-
mod Type m6A Sequence GTATCTGAGCACATCAAGAGACTCTTGTAGCAGTGGTTACC
Motif Score 3.31938095238095
RNA Structure Motif ....(((..(((((...))))).....))).
 MFE -4.00
Support Dataset Num 9 Support sub-Dataset Num 25
Support Dataset List
Support sub-Dataset List

GSM2884197, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM928403, GSM1339393, GSM1339401, GSM2203060, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460348, GSM2460350, GSM2460360, GSM2460362, GSM2754211, GSM2754213, GSM2754226, GSM2754235, GSM2754238, GSM2564019, GSM2602070, GSM2602071
Cell/Tissue List

CD34, HEK293T, hNPCs, Huh7, HEK293A-TOA, iSLK, TREX, NB4, AML
Seq Type List m6A-seq,MeRIP-seq,miCLIP
Transcript ID List ENST00000619232.1,ENST00000613252.5,ENST00000620444.4,ENST00000611519.4
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000619232.1ENSG00000276644.5DACH1protein_codingutr3-12
ENST00000613252.5ENSG00000276644.5DACH1protein_codingutr3-11
ENST00000620444.4ENSG00000276644.5DACH1protein_codingutr3-7
ENST00000611519.4ENSG00000276644.5DACH1protein_codingutr3-8
Conserved Sites mm10:m6A_site_196591;susScr11:m6A_site_17467
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1