RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_238889

mod Site

chr14:21212987-21212988:-

mod Type

m6A

Sequence

GGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTC

Motif Score

3.64304761904762

RNA Structure Motif

....((((....))))...............

MFE

-0.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954, GSE125240, GSE74016

Support sub-Dataset List

GSM2884197, GSE125240, GSM1908206, GSM1908208, GSM1908212

Cell/Tissue List

CD34, kidney, liver, MT4

Seq Type List

m6A-seq,m6A-REF-seq,MeRIP-seq

Transcript ID List

ENST00000554417.1,ENST00000555883.5,ENST00000556897.5,ENST00000553753.5,ENST00000555914.5,ENST00000554539.5,ENST00000420743.6,ENST00000555215.5,ENST00000556628.5,ENST00000557201.5,ENST00000449098.5,ENST00000336053.10,ENST00000557157.5,ENST00000556142.5,ENST00000556513.5,ENST00000553300.5,ENST00000554969.5,ENST00000557442.5,ENST00000430246.6,ENST00000555309.5,ENST00000554383.5,ENST00000554455.5,ENST00000555585.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000554417.1	ENSG00000092199.17	HNRNPC	retained_intron	exon-2
ENST00000555883.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-5
ENST00000556897.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000553753.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000555914.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000554539.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000420743.6	ENSG00000092199.17	HNRNPC	protein_coding	cds-8
ENST00000555215.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-7
ENST00000556628.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000557201.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000449098.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-4
ENST00000336053.10	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000557157.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-4
ENST00000556142.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000556513.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-7
ENST00000553300.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000554969.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-7
ENST00000557442.5	ENSG00000092199.17	HNRNPC	nonsense_mediated_decay	cds-5
ENST00000430246.6	ENSG00000092199.17	HNRNPC	protein_coding	cds-5
ENST00000555309.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000554383.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-7
ENST00000554455.5	ENSG00000092199.17	HNRNPC	protein_coding	cds-6
ENST00000555585.5	ENSG00000092199.17	HNRNPC	retained_intron	exon-1

Conserved Sites

mm10:m6A_site_186651;rheMac8:m6A_site_52060

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

30065315, 31281898, 27572442

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.