RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_238924

mod Site

chr14:21263399-21263400:-

mod Type

m6A

Sequence

AAAAGAAATGAACTTTACTGACTTGACATTTTTGCACCTCC

Motif Score

3.28175

RNA Structure Motif

...............................

MFE

0.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE125780

Support sub-Dataset List

GSM4024125, GSM4024128

Cell/Tissue List

HEK293T

Seq Type List

DART-seq

Transcript ID List

ENST00000557442.5,ENST00000557201.5,ENST00000556628.5,ENST00000555215.5,ENST00000336053.10,ENST00000556226.5,ENST00000556513.5,ENST00000553753.5,ENST00000554383.5,ENST00000557033.1,ENST00000420743.6,ENST00000555309.5,ENST00000557768.1,ENST00000555137.5,ENST00000554969.5,ENST00000555883.5,ENST00000555914.5,ENST00000556142.5,ENST00000554891.5,ENST00000554455.5,ENST00000553300.5,ENST00000554539.5,ENST00000557336.1,ENST00000430246.6,ENST00000555176.5,ENST00000553614.5,ENST00000555127.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000557442.5	ENSG00000092199.17	HNRNPC	nonsense_mediated_decay	intron-1
ENST00000557201.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000556628.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000555215.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000336053.10	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000556226.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000556513.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000553753.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000554383.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000557033.1	ENSG00000092199.17	HNRNPC	retained_intron	exon-2
ENST00000420743.6	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000555309.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000557768.1	ENSG00000092199.17	HNRNPC	protein_coding	utr5-2
ENST00000555137.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000554969.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000555883.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000555914.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000556142.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000554891.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000554455.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000553300.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000554539.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000557336.1	ENSG00000092199.17	HNRNPC	protein_coding	intron-2
ENST00000430246.6	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000555176.5	ENSG00000092199.17	HNRNPC	protein_coding	intron-1
ENST00000553614.5	ENSG00000092199.17	HNRNPC	retained_intron	intron-1
ENST00000555127.1	ENSG00000092199.17	HNRNPC	retained_intron	exon-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

31548708

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.