RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_238943

mod Site

chr14:21269404-21269405:-

mod Type

m6A

Sequence

CATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGT

Motif Score

3.31938095238095

RNA Structure Motif

..........(.(.((((....)))).).).

MFE

-0.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE125803, GSE37003, GSE52600, GSE55572, GSE71154, GSE90914, GSE93676, GSE93911

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3582048, GSM908337, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1828594, GSM2417477, GSM2417478, GSM2417479, GSM2460354, GSM2464905, GSM2464907, GSM2464911, GSM2464913

Cell/Tissue List

HeLa, HepG2, H1B, H1A, fibroblasts, A549, CD8T, HEK293A-TOA, MSC, endometrial

Seq Type List

m6A-seq,MeRIP-seq,m6A-CLIP/IP

Transcript ID List

ENST00000557768.1,ENST00000553614.5,ENST00000556628.5,ENST00000554455.5,ENST00000555137.5,ENST00000555309.5,ENST00000556142.5,ENST00000420743.6,ENST00000554383.5,ENST00000557201.5,ENST00000555215.5,ENST00000554969.5,ENST00000556513.5,ENST00000557336.1,ENST00000553300.5,ENST00000557442.5,ENST00000554539.5,ENST00000336053.10,ENST00000556226.5,ENST00000557033.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000557768.1	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000553614.5	ENSG00000092199.17	HNRNPC	retained_intron	exon-1
ENST00000556628.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000554455.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000555137.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000555309.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000556142.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000420743.6	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000554383.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000557201.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000555215.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000554969.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000556513.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000557336.1	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000553300.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000557442.5	ENSG00000092199.17	HNRNPC	nonsense_mediated_decay	utr5-1
ENST00000554539.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000336053.10	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000556226.5	ENSG00000092199.17	HNRNPC	protein_coding	utr5-1
ENST00000557033.1	ENSG00000092199.17	HNRNPC	retained_intron	exon-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913, 22575960, 25456834, 24981863, 26404942, 28525753, 29109479, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.