RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_240062

mod Site

chr14:22928489-22928490:-

mod Type

m6A

Sequence

GCTGTCAGGAAGGGGTAGGGACCATCCCATATGCCCCTTAA

Motif Score

3.62240476190476

RNA Structure Motif

......((.(((((((...)))).))).)).

MFE

-9.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE125803, GSE85724, GSE87190, GSE87515, GSE93676, GSE93911, GSE94808, GSE97408

Support sub-Dataset List

GSM2991403, GSM2987449, GSM3582052, GSM3582053, GSM3582054, GSM2283212, GSM2283213, GSM2283214, GSM2283215, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2754214, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464927, GSM2464931, GSM2483505, GSM2564019

Cell/Tissue List

HeLa, HepG2, A549, Jurkat, CD4T, peripheral-blood, GSC-11, iSLK, endometrial, HEC-1-A, GSCs, NB4

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000553897.5,ENST00000556426.1,ENST00000557015.1,ENST00000397440.8,ENST00000553550.5,ENST00000554867.5,ENST00000556616.5,ENST00000216350.12,ENST00000553641.5,ENST00000553787.5,ENST00000397441.6,ENST00000557415.5,ENST00000553915.5,ENST00000554716.5,ENST00000324366.13,ENST00000421938.2,ENST00000554910.5,ENST00000627278.1,ENST00000556032.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000553897.5	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000556426.1	ENSG00000100462.16	PRMT5	processed_transcript	exon-2
ENST00000557015.1	ENSG00000100462.16	PRMT5	retained_intron	exon-2
ENST00000397440.8	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000553550.5	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000554867.5	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000556616.5	ENSG00000100462.16	PRMT5	protein_coding	intron-1
ENST00000216350.12	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000553641.5	ENSG00000100462.16	PRMT5	processed_transcript	intron-2
ENST00000553787.5	ENSG00000100462.16	PRMT5	nonsense_mediated_decay	intron-1
ENST00000397441.6	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000557415.5	ENSG00000100462.16	PRMT5	nonsense_mediated_decay	intron-1
ENST00000553915.5	ENSG00000100462.16	PRMT5	nonsense_mediated_decay	intron-1
ENST00000554716.5	ENSG00000100462.16	PRMT5	processed_transcript	intron-2
ENST00000324366.13	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000421938.2	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000554910.5	ENSG00000100462.16	PRMT5	protein_coding	intron-2
ENST00000627278.1	ENSG00000100462.16	PRMT5	protein_coding	intron-1
ENST00000556032.1	ENSG00000100462.16	PRMT5	retained_intron	exon-2

Conserved Sites

mm10:m6A_site_187435

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 3086759, 31597913, 27371828, 29249359, 28344040, 29109479, 30154548, 28297667, 29290617

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.