| mod ID | m6A_site_240066 | mod Site | chr14:22929189-22929190:- | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TCGGGGACGGAGAAGGGCAGACTAGTCATCCCGGAGAAGCA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..(((.((..(((......))).)))))... |
MFE | -7.40 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 43 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739534, GSM2739535, GSM2991403, GSM2987449, GSM3582046, GSM3582047, GSM3582048, GSM3582052, GSM3582053, GSM3582054, GSM1272368, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283214, GSM2283215, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2417477, GSM2417478, GSM2417479, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460360, GSM2754214, GSM2754238, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464931, GSM2483505, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, A549, H1B, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TREX, TIME, endometrial, HEC-1-A, GSCs, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000627278.1,ENST00000216350.12,ENST00000554867.5,ENST00000554716.5,ENST00000556426.1,ENST00000553641.5,ENST00000557015.1,ENST00000556616.5,ENST00000397440.8,ENST00000324366.13,ENST00000553787.5,ENST00000421938.2,ENST00000397441.6,ENST00000553550.5,ENST00000557415.5,ENST00000556032.1,ENST00000553915.5,ENST00000553897.5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_187439;susScr11:m6A_site_125286 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1