RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_254937

mod Site

chr14:73287205-73287206:-

mod Type

m6A

Sequence

CTACTTTTGATGCTAGTCGGACCACTTTTACAAGAGAAGGA

Motif Score

3.62240476190476

RNA Structure Motif

((((((....))))))...............

MFE

-2.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954, GSE93911

Support sub-Dataset List

GSM2884197, GSM2884199, GSM2464919

Cell/Tissue List

CD34, endometrial

Seq Type List

m6A-seq

Transcript ID List

ENST00000555238.5,ENST00000555394.5,ENST00000560335.5,ENST00000555738.6,ENST00000535282.5,ENST00000555307.5,ENST00000554315.5,ENST00000554546.5,ENST00000559312.5,ENST00000556989.1,ENST00000356296.8,ENST00000359560.7,ENST00000355058.7,ENST00000553997.5,ENST00000554394.5,ENST00000555859.5,ENST00000554521.6,ENST00000544991.7,ENST00000556772.5,ENST00000557597.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000555238.5	ENSG00000133961.20	NUMB	protein_coding	cds-9
ENST00000555394.5	ENSG00000133961.20	NUMB	protein_coding	cds-9
ENST00000560335.5	ENSG00000133961.20	NUMB	protein_coding	cds-7
ENST00000555738.6	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000535282.5	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000555307.5	ENSG00000133961.20	NUMB	protein_coding	cds-8
ENST00000554315.5	ENSG00000133961.20	NUMB	retained_intron	exon-7
ENST00000554546.5	ENSG00000133961.20	NUMB	protein_coding	cds-8
ENST00000559312.5	ENSG00000133961.20	NUMB	protein_coding	cds-7
ENST00000556989.1	ENSG00000133961.20	NUMB	retained_intron	exon-3
ENST00000356296.8	ENSG00000133961.20	NUMB	protein_coding	cds-9
ENST00000359560.7	ENSG00000133961.20	NUMB	protein_coding	cds-5
ENST00000355058.7	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000553997.5	ENSG00000133961.20	NUMB	processed_transcript	exon-1
ENST00000554394.5	ENSG00000133961.20	NUMB	protein_coding	cds-8
ENST00000555859.5	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000554521.6	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000544991.7	ENSG00000133961.20	NUMB	protein_coding	cds-6
ENST00000556772.5	ENSG00000133961.20	NUMB	protein_coding	cds-3
ENST00000557597.5	ENSG00000133961.20	NUMB	protein_coding	cds-8

Conserved Sites

mm10:m6A_site_141452

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

30065315, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.