| mod ID | m6A_site_256769 | mod Site | chr14:75281579-75281580:+ | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCAGGCTGTGGGCCTCAAGGACTTGAAAGCATCCATGTGTG |
|||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||
| RNA Structure Motif |
..((((((.((((....))))..))..)))) |
MFE | -4.40 | |||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 39 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3396437, GSM3396438, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1828596, GSM2010454, GSM2010456, GSM2203060, GSM2283214, GSM2324308, GSM2324310, GSM2417477, GSM2417478, GSM2417479, GSM2754226, GSM2464907, GSM2464915, GSM2464917, GSM2464919, GSM2602070 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, HepG2, MM6, Huh7, CD4T, peripheral-blood, HEK293A-TOA, TREX, endometrial, AML |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP,miCLIP | |||||||||||||||||||||||||
| Transcript ID List | ENST00000535987.5,ENST00000555686.1,ENST00000303562.9,ENST00000555347.1 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_143043;rn6:m6A_site_86845;susScr11:m6A_site_126682 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1